19th-banner-rev.gif

Albany 2001

category image Biomolecular
Stereodynamics
SUNY at Albany
June 19-23, 2001

Vibrational Circular Dichroism study of parallel- and antiparallel-stranded hairpin structures.

VCD is the vibrational counterpart of CD spectroscopy. It has been very successful for studying nucleic acid structures and changes in the structure upon varying environmental conditions, introducing different metal ions, and binding anticancer drugs. VCD spectroscopy has proven suitable for studies on short nucleic acid oligomers, as well as natural and synthetic nucleic acids polymers. We wish to report the results from some of our latest attempts, namely those dealing with extending our VCD knowledge to unconventional nucleic acid structures.

The study involves a pair of hairpins with TTTTTTTTTCCCCAAAAAAAA base composition. An introduction of a 5'-p-5' phosphodiester bond at the TC step inverts the direction of the T tract and facilitates formation of unconventional, parallel-stranded hairpin. Our goal is to establish the sensitivity of VCD to changes in the structure introduced in the DNA double helix by reversing the polarity of one of the strands. The results can serve further studies on the interplay of various nucleic acid structural forms and multi-stranded formations upon changes in chemical and other environmental conditions.

M. Krasteva and H. Wieser,

Department of Chemistry, Faculty of Science, University of Calgary, Calgary, AB, T2N 1N4; J.H. van de Sande, Department of Medical Biochemistry, Faculty of Medicine, University of Calgary, Calgary, AB, T2N 1N4.
phone: (403) 220-5365; fax: (403) 289 9488; e-mail: mkrastev@ucalgary.ca