Book of Abstracts: Albany 2007

category image Albany 2007
Conversation 15
June 19-23 2007

SNP Detection of the Cytochrome P450 2C9*3 Mutation using DNA-assembled Exciplexes

Human Cytochrome P450 2C9 (CYP2C9) is a polymorphic enzyme responsible for the metabolism of a large number of clinically important drugs such as phenytoin, S-warfarin, tolbutamide, and nonsteroidal anti-inflammatory drugs (1, 2). A Single Nucleotide Polymorphism, (SNP) in the CYP2C9 gene termed CYP2C9*3 (A1061C) results in the amino acid substitution Ile359Leu. This leads to altered enzyme activity and drug sensitivity, e.g., the mutant enzyme results in impaired hydroxylation of S-warfarin (3). We now describe the application of a novel technology to detect CYP2C9*3 in a homogeneous assay using oligonucleotide probes (Exciprobes). The detection system is split at a molecular level into signal-silent components, i.e., two oligonucleotide probes bearing components (A and B) of the eventual fluorophore exciplex and their complementary target sequence (Figure 1) (4).

Figure 1: Target assembly of pyrene- and naphthalene-labelled exciprobes in tandem.

The tandem probes are labelled with pyrenyl (A) or naphthalenyl (B) exciplex partners at the 5? or 3? termini, respectively. On hybridisation to the target strand, the target and probe components are assembled into a specific 3-dimensional structure that results in the formation of an exciplex (excited state complex) when excited with light at 350nm. This exciplex is detected by an increase in fluorescence at 480 nm (Stokes shift 130 nm).

We evaluated two exciplex detection systems for the CYP 2C9 *3 target sequence. The first consisted of two 8-mer probes designed to anneal to a 16-base target in the region of the *3 allele (GGTCCAGAGATACATT). The second system used two 12-mer probes (extended versions of the 8-mers) which anneal to a 24-base target region (ACGAGGTCCAGAGATACATT GACC). The site of the *3 mutation is shown in bold and underlined.

The probes were used to differentiate the Wild Type or *3 mutant alleles of CYP2C9. Target DNA was in the form of short synthetic oligonucleotides, PCR products (150-base) or cloned into plasmid DNA (∼3 kb). Using the 8-mer or 12-mer split-probes, annealed to their complementary oligonucleotide target in buffer containing 80% (v/v) trifluoroethanol, a characteristic exciplex fluorescence was observed at 480 nm after excitation at 350 nm. This was accompanied by quenching and slight red shift in the pyrene signal. With *3 SNP targets, exciplex signals of lower fluorescence intensity were detected with both sets of probes, and there was a decrease in the Tm of the hybrid duplex. The DNA melting curves obtained at the exciplex fluorescence wavelength were sigmoidal in shape, indicative of duplex formation and exciplex formation. The low fluorescence background (massive Stokes shift) and the SNP-discriminating power of the Exci-probes makes the technology simple, rapid and inexpensive, suitable for routine high-throughput assays, with promise for future applications in genetic testing and molecular diagnostics.

References and Footnotes
  1. M. Hiratsuka, Y. Agatsuma, M. Mizugaki, Molecular Genetics and Metabolism 68, 357?362 (1999).
  2. Z. Zainuddin, L. K. Teh, A. W. M. Suhaimi, M. Z. Salleh, R. Ismail. Clinica Chimica Acta 336, 97?102 (2003).
  3. P. G. Aithal, P. C. Day, J. P. Kesteven, A. K. Daly. Lancet 353, 717-719 (1999).
  4. E. V. Bichenkova, H. E. Savage, A. R. Sardarian, K. T. Douglas. Biochem Biophys Res Commun 332, 956?964 (2005).

Abdul Gbaj
Lindsey Walsh
Elena V. Bichenkova
Laura L. Etchells
Kenneth T. Douglas*

Wolfson Centre for Rational Structure-Based Design of Molecular Diagnostics
School of Pharmacy and Pharmaceutical Sciences
University of Manchester
Manchester, M13 9PL, U.K

*Phone: +44 (0)161 275 2371
Fax: +44 (0)161 275 2481
Email: Ken.Douglas@manchester.ac.uk