19th-banner-rev.gif

Book of Abstracts: Albany 2003

category image Albany 2003
Conversation 13
Abstract Book
June 17-21 2003

Probing the Interactions of a DNA Triple Helix with Metal Ions by Proton Exchange and NMR Spectroscopy

The interactions of metal ions with nucleic acids have been the subject of extensive experimental and theoretical studies. The stabilizing effect of metal ions on nucleic acid structures results mostly from their electrostatic interaction with nucleic acid charges. Specific binding sites for metal ions have been identified in various RNA and DNA structures using crystallographic and computational methods. In the present work we show that the measurement of proton exchange rates by NMR spectroscopy provides information on site-specific interactions of metal ions with nucleic acids. The approach is illustrated by a study of the interaction of magnesium and sodium ions with the intramolecular triple helix formed by the DNA oligonucleotide 5?-d(GAAGAGGTTTTTCCTCTTCTTTTTCTTCTCC)-3?. The exchange rates of imino protons in individual Watson-Crick and Hoogsteen base pairs in the triple helix were measured as a function of magnesium and sodium concentration at pH 4.6 and 5° C. The results show that binding of magnesium or sodium ions to the DNA triple helix affects the exchange rates of imino protons. For most bases, the binding of metal ions lowers the imino proton exchange rates, most likely by stabilizing the closed (paired) conformation of each base. The effects of magnesium ions are larger than those of sodium ions. The effects also depend on the nature of the counterion condensed on the DNA triple helix, the nature of the base, the position of the base relative to the ends of the structure and the position of the base relative to the protonated cytosines. These findings demonstrate that imino proton exchange is a sensitive probe for the local distribution of metal ions in nucleic acid structures.

Daniel Coman
Irina M. Russu

Department of Chemistry and Molecular Biophysics Program
Hall-Atwater Laboratories
Wesleyan University
Middletown, CT 06459
dcoman@wesleyan.edu
irussu@wesleyan.edu