Book of Abstracts: Albany 2005

category image Volume 22
No. 6
June 2005

Phthalocyanine-oligonucleotide Conjugates: Synthesis, Thermodynamics, and DNA Modification

Phthalocyanines (Ptc) is now of interest as a drugs for photodynamic therapy (PDT) of malignant tumors. Their therapeutic effect is based on the ability to sensitize the generation of singlet molecular oxygen 1O2 under irradiation. Besides, it is well-known that some metal-Ptc can catalyze in dark conditions the formation of other reactive oxygen species (ROS), such as O-2, H2O2, O•H. These species are capable of damaging various cell constituents including DNA. Thus, these properties of Ptc make them very attractive as reactive groups to be linked to antisense oligonucleotides for specific DNA chemical modification.

We have developed the solid-phase method of synthesis of deoxyribooligonucleotide conjugates carrying Al(III)-, Zn(II)-, and Co(II)- tetracarboxy-phthalocyanines groups. The thermodynamics of duplexes and triplexes formed between conjugates and single-stranded (ss) or double-stranded (ds) DNA as well as DNA modification have been studied.

Deoxyribooligonucleotides were synthesized by standard phosphoramidite method and contained an -O-(CH2)3NH2 linker at their 5'-end phosphates. The carboxyl groups of Ptc were converted into their N-hydroxysuccinimide esters and then coupled with oligonucleotides that were still attached to control pore glass (CPG) beads. The resulting conjugates were deprotected and cleaved from the CPG with concentrated aqueous ammonium hydroxide. Finally, the conjugates were purified by preparative reversed phase HPLC in acetonitrile/H2O gradient. The yields of conjugates were 30-40%.

Thermodynamics of interaction of phthalocyanine-oligonucleotide conjugates with ss- and dsDNA were measured by UV melting method at 260, 270, 280, 300,and 360 nm and CD spectroscopy. The results demonstrated the stabilizing effect of phthalocyanine moiety on the formation of both duplexes and triplexes DNA.

The irradiation of the reaction mixture containing either Zn(II) or Al(III) tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) by the light with the wave length >340 nm (Hg-lamp or He/Ne-laser) resulted in modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). Conjugate of Co(II)-tetracarboxyphthalocyanine with oligonucleotide was found to modify the DNA target in the presence of O2 and 2-mercaptoethanol or in the presence of H2O2. In both sensitized and catalyzed conditions the nucleotides G13-G15 were mainly modified giving the evidence that reaction proceeded in complementary complexes.

The damages in DNA were revealed by the treatment of products with piperidine or 8-oxoguanine-DNA-glycosylase from E. coli. These results provide information about potential use of phthalocyanine-oligonucleotide conjugates as new artificial regulators of gene expression and therapeutics for treatment of cancer diseases.


This research was made possible in part by grants from the RFBR (05-04-48447), MCB Program of RAS (10.6), the Russian Ministry of Education and Science (NS-1419.2003.4), and Novosibirsk Regional Foundation for Support of Science and Higher Education. V. V. K. was supported by grant (No. Y1-B-08-16) from CRDF and from the Russian Ministry of Education & Science within the Program ?Basic researches and higher education? and by Post Doctoral Fellowship from INTAS (04-83-3849).

Vladimir Koval1,2,*
Alexander Chernonosov1,2
Alexandra Kuznetsova1,2
Nikita Kuznetsov1,2
Dmitri Pyshnyi1,2
Valentina Derkacheva3
Eugene Lukyanets3
Olga Fedorova1,2

1Institute of Chemical Biology and Fundamental Medicine
Siberian Branch of the Russian Academy of Sciences
Novosibirsk 630090, Russia
2Novosibirsk State University
Novosibirsk 630090, Russia
3Organic Intermediates & Dyes Institute
B. Sadovaya, 1/4
Moscow, 103787, Russia

*Email: koval@niboch.nsc.ru