Book of Abstracts: Albany 2009

category image Albany 2009
Conversation 16
June 16-20 2009
© Adenine Press (2008)

Monovalent Cation Binding by DNA Hairpins

The binding of monovalent cations to DNA hairpins has been studied by capillary electrophoresis, using a variation of affinity electrophoresis called the Variable Ionic Strength method. A 16-residue oligonucleotide with the sequence ATCCTATTTTTAGGAT, which is known to form a stable hairpin with a 6 bp stem and 4 residue loop, was used as a model hairpin. A 26-residue nucleotide with the sequence CGGTGCGGAAAAACGAGCTTTTTGCG, which is predicted to form an imperfect hairpin with a 7 bp stem, a 5 residue loop and a 5? dangling end, was also studied. Unstructured oligomers containing similar numbers of nucleotides were used as reference analytes. The hairpins migrate faster than their unstructured counterparts because the hairpins are more compact and experience less friction with the solvent. Li+, Na+, K+, NH4+, and Tris+ ions form saturable complexes with the model hairpin, with average apparent KDs of ~80 mM at 20 °C. The decrease in mobility with increasing cation concentration indicates that about 4 cations bind to the model hairpin upon saturation of the binding site(s). Cation binding appears to decrease with increasing temperature, suggesting that cation binding does not contribute to increased hairpin stability at high ionic strengths. Alkylammonium ions with small substituents, such as the tetramethylammonium or monopropylammonium ion, bind to the model hairpin in a manner similar to that observed for NH4+. However, as the hydrogen atoms in the ammonium ion are replaced by alkyl groups, or as the alkyl groups in the tetraalkylammonium ion become larger, binding to the model hairpin becomes significantly weaker. Similar results are observed with the imperfect hairpin, although the binding affinities are somewhat weaker. Supported in part by grant CHE-0748271 from the Analytical and Surface Chemistry Program of the National Science Foundation.

Nancy C. Stellwagen
Joseph Muse
Paul Barnard
Earle Stellwagen

Dept of Biochemistry
University of Iowa
Iowa City, IA