19th-banner-rev.gif

Book of Abstracts: Albany 2003

category image Albany 2003
Conversation 13
Abstract Book
June 17-21 2003

Intercalation of T·T Pairs and Duplex Inter-conversion within the I-motif Structure

Protonation of C-rich deoxy and ribo-oligonucleotides results in the formation of a four-stranded structure composed of two parallel duplexes in a head to tail orientation with their hemi-protonated C·C+ pairs intercalated in a so-called i-motif. This motif forms a new structural class into the collection of nucleic acid structures. It may be formed by four strands, by the assembly of two symmetry-related hairpins containing two cytidine stretches. The fragment, d(CCCTAACCCTAACCCTAACCC), of the vertebrate telomer folds into an intramolecular i-motif. In many tetrameric i-motif structures, the four strands are identical on the NMR time scale. We have observed that incorporation of TT pairs into the i-motif may break the tetramer symmetry. Indeed, in the d(CCTCC) tetramer, the thymidines are paired in one duplex and unstacked in the other. The simultaneous opening-closing of the TT pairs switches the duplexe structures within the tetramer (1).

Duplex inter-conversion is observed in many i-motif structures containing C and T residues. In the tetramer of CCTCTCC, duplex interconversion results in a concerted opening-closing motion of the two distant T3·T3 and T5·T5 pairs (figure). None of the two structures formed of two identical duplexes containing a TT pair (T3T3 or T5T5) and a non paired thymidine (T5 or T3) are observed.


A similar switching motion is observed in the tetramer of CCTCCTCC, but in this sequence the opening-closing motions of the TT pairs are independent. By contrast, duplex interconversion is not observed in the fully symmetrical tetramers of CCTCCCTCC and of CCTCTCTCC. In [d(CCTCCCTCC)]4, the thymidine T3 of each strand is unstacked and the thymidines T7 form two T·T pairs stacked to the adjacent C6·C6+ pairs. This is also the case for the tetramer of CCTCTCTCC but in this structure, the central thymidines T5 form two very stable T·T pairs (lifetime in the second range at 0°C) which are incorporated into the i-motif.

These extraordinary diversity of the situations observed when T·T pairs are incorporated in i-motif structures will be discussed.

Jean Louis Leroy

Laboratoire de RMN รก Haut Champ
Institut de Chimie des Substances naturelles
Gif-sur-Yvette
France
Jean-Louis.Leroy@icsn.cnrs-gif.fr

References and Footnotes
  1. Nonin, S. and Leroy J.-L., J. Mol. Biol. 261, 399-414 (1996).