Albany 2001

category image Biomolecular
SUNY at Albany
June 19-23, 2001

CD Evidence that Ff g5p Selectively Binds to the Structured Form of a G-rich DNA Oligomer in the Presence of Sodium Ion.

The Ff gene 5 protein (g5p) binds cooperatively to and saturates the Ff genomic single-stranded DNA in a non-sequence-specific fashion to form a complex that is a precursor to the mature Ff phage structure. The g5p also has sequence-specific binding functions during the Ff phage life cycle. We have found that g5p binds strongly to a SELEX-selected G-rich 58-mer under solution conditions of 200 mM NaCl, 37¼C, pH 7.4. Under these conditions, circular dichoism (CD) and other measurements provide evidence that the 58-mer (named I-3) and its 26-mer core sequence of GGGGTCAGGCTGGGGTTGTGCAGGTC form unimolecular G-tetraplex structures. In the presence of potassium ion, the 26-mer has the CD spectrum of a chair-type G-tetraplex structure. The highest binding is to a somewhat altered G-paired structure that is characterized by an enhanced 260 nm CD band in the presence of sodium ion. Although a 260 nm CD band is often associated with parallel-stranded G-tetraplexes, I-3 does not obviously form a multistranded structure under these conditions. Binding of g5p results in a further increase in the 260 nm CD band of both sequences. This increase could indicate an increased stacking within the G4 segments. An unexpected finding was that I-3 is saturated in two discrete stages, with several g5p dimers binding directly to the core G-rich structure in the first stage. We have been able to establish by CD spectroscopy that both the intermediate and the g5p-saturated forms of I-3 retain structured 26-mer core sequences. The implications are that the g5p, a model for binding ssDNAs, may have greater avidity for specific DNA structures than has been recognized and that the binding of g5p to G-rich motifs may reflect the binding of such motifs by other proteins.

Jin-Der Wen and Donald M. Gray

Department of Molecular and Cell Biology, FO 31 The University of Texas at Dallas P.O. Box 830688 Richardson, TX 75083-0688
jdwen@utdallas.edu; dongray@utdallas.edu; ph: (972) 883-2513; fx:: (972) 883-2409