Human trinucleotide repeat expansion diseases (TREDs) are caused by expanded tracts of repeated triplet sequences, and can be categorized into two classes [reviewed in (1)]. The first class, referred to as ?polyglutamine diseases?, is characterized by exonic (CAG)_n repeat expansions encoding polyglutamine tracts. This group has several similar features and probably shares common mechanism of pathogenesis, resulted from expanded polyglutamine tracts in proteins (2, 3). The second class has its repeats in non-coding sequences, and is typically characterized by large and variable repeat expansions, which result in multiple tissue dysfunctions. The trinucleotide repeat sequences vary in this class, with triplets CGG, CCG, CTG, CAG, and GAA causing different diseases. The repeating sequence and its location are important factors, dictating the unique mechanism of pathogenesis for each disease. The mechanism by which the expanded trinucleotide repeat in non-coding regions leads to abnormal cellular function is not clear, but defects most likely originate at the nucleic acid rather than the protein level (1). I hypothesize that (see Figure 1):

1. transcription of d(CNG)_n repeat expansions (where N = T, G, C, or A) promote the formation of the double-helical RNA hairpin, in which non-canonical N·N base pairs are flanked/stabilized at each side by two consecutive Watson-Crick C·G base pairs;
2. such a ?double-stranded? RNA (dsRNA) becomes a source for microRNAs (miRNAs) or/and small interfering RNAs (siRNAs), which [see (4) for a comprehensive review];
3. negatively regulate the expression or cause the translational repression or mediate a post-transcriptional RNA silencing (siRNA guided mRNA degradation) of the genes containing the d(CN*G)_n tracts with n ≥ 7 (which is the length of siRNA, 21-26 nucleotides, divided by a codon length 3; N* is complementary to N), or regions very similar to d(CN*G)_n; and
4. the linkage between triplet repeat expansion and the onset of genetic neuromuscular and neurodegenerative diseases is due to elimination of the proteins encoded by these genes.

Figure 1: A schematic illustrating the hypothetic molecular mechanism for TREDs. N is a specific nucleotide of a triplet repeat (T, G, C, or A), while N* is complementary to N.

In particular, a progressive neuromuscular disorder myotonic dystrophy 1 (DM1) results from a d(CTG)_n triplet expansion located in the 3'-untranslated regions of the dystrophia myotonica protein kinase gene (5). The data related to DM1 supporting my hypothesis are as follow: (i) the expression of expanded CUG repeats was shown to be sufficient to result in the development of myotonia and other changes that are characteristic of DM1 (6, 7, 8, 9); (ii) functional inactivation of the musceleblind proteins, MBNLs, in mice results in skeletal muscle myotonia (10), with MBNL1 suggestively being the primary determinant for the disorder (11); and (iii) MBNL1 amino acid sequence involves the (Ala)₇ region, which is encoded in the gene (NCBI DNA data base: entry Y13829) by the nucleotide sequence d(GCAGCTGCTGCAGCTGCTGCA), or in mRNA by the nucleotide sequence GCAGCUGCUGCAGCUGCUGCA. The later sequence is near-complementary (except for four single U·U mismatches, which are flanked/stabilized at each side by two C·G base pairs) to the repeated CUG triplet sequence UG(CUG)₆C of the suggested siRNA, which therefore might make silent the MBNL1 gene. The expected efficiency of such a silencing is lower than in case of the exact complementarity, since mismatches were shown to reduce (but do not abolish) the silencing effect (12, 13), with single U·U mismatches having a tolerant influence in most locations (14). On the other hand such a siRNA, if exists, would more efficiently activate the RNA silencing of the genes containing the regions of repeated CAG triplets, complementary to the CUG repeated sequence of siRNA. For instance, myosin phosphatase-Rho interacting protein [M-RIP; (15)], which is expressed in vascular smooth muscle, is one of the potential candidates to be depleted, because its gene involves the AG(CAG)₉C fragment encoding the (Ser)₁₀ region in the protein (NCBI DNA data base: entry AY296247). Proteins with polyglutamine tracts encoded by (CAG)_n repeats, which were mentioned above in relation with ?polyglutamine diseases? (1), can also be depleted. Other potential candidates have to be searched for. The diversity of phenotype in myotonic dystrophy (5) may be due to the fact that the number of protein depleted and the efficiency of their depletion depend on the number of siRNA molecules. As the number of siRNA molecules increases, they start silencing mRNA with mismatches, which they could not silence at a low copy number. It is consistent with the fact that the severity of DM1 correlates with the size of (CUG)_n tracts, which can be expanded up to thousands nucleotides (1).

One of the existing hypothetic explanations of the DM1 molecular mechanism is that the expansion of the CUG repeats causes the sequestration of the CUG-binding proteins, including the MBNL1 (10). It is noteworthy, that several mechanisms could exist, with all resulting in the disorder. The proposed pathway might play a general role for TREDs, and may be very important for understanding the molecular origin of these human diseases. At present, efforts are focused on understanding of the mechanisms by which repeats tend to expand in DNA, with recent years bringing a noticeable progress in the field (16, 17, 18). The objective of the hypothesis proposed in the present communication is to attract attention to another face of the problem.

References and Footnotes

1. C. J. Cummings and H. Y. Zoghbi. Annu. Rev. Genomics Hum. Genet. 1, 281-328 (2000).
2. H. Green. Cell 74, 955-956 (1993).
3. M. F. Perutz, T. Johnson, M. Suzuki, and J. T. Finch. Proc. Natl. Acad. Sci. USA 91, 5355-5358 (1994).
4. G. Meister and T. Tuschl. Nature 431, 343-349 (2004).
5. J. D. Brook et al. Cell 68, 799-808 (1992).
6. A. Mankodi, E. Logigian, L. Callahan, C. McClain, R. White, D. Henderson, M. Krym, and C. A. Thornton. Science 289, 1769-1773 (2000).
7. H. Seznec, O. Agbulut, N. Sergeant, C. Savouret, A. Ghestem, N. Tabti, J. C. Willer, L. Ourth, C. Duros, E. Brisson, C. Fouquet, G. Butler-Browne, A. Delacourte, C. Junien, and G. Gourdon. Hum. Mol. Genet. 10, 2717-2726 (2001).
8. A. Mankodi, M. P. Takahashi, H. Jiang, C. L. Beck, W. J. Bowers, R.T. Moxley, S. C. Cannon, and C. A. Thornton. Mol. Cell 10, 35-44 (2002).
9. N. Charlet-B, R. S. Savkur, G. Singh, A. V. Philips, E. A. Grice, and T. A. Cooper. Mol. Cell 10, 45-53 (2002).
10. R. N. Kanadia, K. A. Johnstone, A. Mankodi, C. Lungu, C. A. Thornton, D. Esson, A. M. Timmers, W. W. Hauswirth, and M. S. Swanson. Science 302, 1978-1980 (2003).
11. W. Dansithong, S. Paul, L. Comai, and S. Reddy. J. Biol. Chem. 280, 5773-5780 (2005).
12. S. M. Elbashir, J. Martinez, A. Patkaniowska, W. Lendeckel, and T. Tuschl. EMBO J. 20, 6877-6888 (2001).
13. T. Holen, M. Amarzguioui, M. T. Wiiger, E. Babaie, and H. Prydz. Nucleic Acids Res. 30, 1757-1766 (2002).
14. Q. Du, H. Thonberg, J. Wang, C. Wahlestedt, and Z. Liang. Nucleic Acids Res. 33, 1671-1677 (2005).
15. H. K. Surks, C. T. Richards, and M. E. Mendelsohn. J. Biol. Chem. 278, 51484-51493 (2003).
16. S. M. Mirkin. Nat. Struct. Mol. Biol. 12, 635-637 (2005).
17. G. B. Panigrahi, R. Lau, S. E. Montgomery, M. R. Leonard, and C. E. Pearson. Nat. Struct. Mol. Biol. 12, 654-662 (2005).
18. B. A. Owen, Z. Yang, M. Lai, M. Gajek, J. D. Badger, J. J. Hayes, W. Edelmann, R. Kucherlapati, T. M. Wilson, and C. T. McMurray. Nat. Struct. Mol. Biol. 12, 663-670 (2005).