Book of Abstracts: Albany 2005

category image Volume 22
No. 6
June 2005

Acceleration of De Novo DNA Synthesis by Restriction Enzymes

We have found that in the presence of a restriction endonuclease, DNA polymerase efficiently synthesizes and amplifies DNA in the absence of any added template and primer nucleic acid under isothermal conditions. In the presence of restriction endonuclease Tsp509I (recognition sequence: ↓AATT) or TspRI (recognition sequence: NNCAG(C)TGNN↓), more than 90% of the available dNTPs can be consumed by Vent (exo-) DNA polymerase in 1 h at 70°C. The synthesized DNA has a highly repetitive palindromic sequence containing recognition sites for the restriction enzyme, e.g. (AAAAATTTTT)n and (ATACACTGTATATACAGTGTAT)n. Our data show that the high efficiency of the restriction-endonuclease-DNA-polymerase (RE-pol) DNA synthesis results from an efficient exponential amplification involving digestion-elongation cycles (See the Scheme below).



The purposed mechanism of the RE-pol DNA synthesis. A) Hairpin-elongation model for the expansion of a tandem repetitive sequence. The length of DNA is doubled after every cycle and a very long hairpin-structured DNA is synthesized by repeating the strand displacement extension. B) Digestion-elongation model for efficient amplification of DNA. The synthesized long double-stranded DNA with numerous recognition sites is digested by the restriction enzyme to short fragments; then the short fragments are elongated by DNA polymerase to give long DNA.

The RE-pol DNA synthesis seems a common characteristic of many restriction enzymes and DNA polymerases. DNA has been de novo synthesized by using dozens of restriction enzymes and several DNA polymerases. It can also be carried out at 37°C or lower temperature. It can be expected that when several restriction enzymes are mixed, the DNA involving more genetic information might be obtained. Our findings suggest that the digestion of nucleic acids (either DNA or RNA) may play an important role in the evolution of genetic material for procreating the diversification of genetic information on the early earth. Using a similar mechanism as RE-pol, a reaction consisting of polymerization (growth) and digestion (generation of new seeds) might be responsible for the foundations of life. The polymerization and digestion activity could be carried out by either protein, RNA, or other functional molecules.

References and Footnotes
  1. Liang X., Jensen, K., and Frank-Kamenetskii, M. D. Biochemistry 43, 13459-13466 (2004).
  2. Ogata, N. and Miura, T. Nucleic Acids Res. 26, 4657-4661 (1998).

Xingguo Liang*
Kari Jensen
Maxim D. Frank-Kamenetskii

Center for Advanced Biotechnology
Department of Biomedical Engineering
Boston University
36 Cummington Street
Boston, Massachusetts 02215, USA

*Phone: (617)353-8492
Fax: (617)353-8501
Email: liangxg@bu.edu