Albany 2001

category image Biomolecular
SUNY at Albany
June 19-23, 2001

Binding of p53 Protein to Supercoiled DNA

Two DNA-binding domains (core domain and C-terminal) of tumor suppressor protein p53 are able to recognize several specific DNA motifs (e.g. specific consensus sequence, ssDNA, structural DNA motifs) (1). DNA topology is of fundamental importance for a wide range of biological processes, including DNA transcription, replication, recombination, control of gene expression and genome organization in which p53 protein plays a role. Generally, the binding of proteins to DNA is often supercoiling dependent. Here we show that the DNA supercoiling enhances p53 binding to different consensus sequences (CONs), including p21, RGC1 and the synthetic sequence AGACATGCCTAGACATGCCT in pPGM1 DNA. Furthermore, p53 binding to CON in supercoiled (sc) DNA is similar but not identical to binding to CON in linear DNA when modulated by monoclonal antibodies (2). We propose that structural changes in CON and flanking sequences in scDNA can affect the p53 binding and complex interactions of p53 domains in binding to scDNA might be involved.

We have found that p53 binds preferentially to negatively scDNA (in the absence of CON) forming a ladder of bands on the agarose gel (3-5). Both, core domain and C-terminal part of p53 have been suggested to participate in preferential scDNA binding. We employed several deletion mutants of bacterially expressed p53 protein to compare importance of the domains for the high affinity to scDNA. Preference (sc/lin) of the isolated p53 core domain (aa 94-312) is much lower than that of the full-length p53 (6). In contrast, isolated p53 C-terminus (aa 320-393) exhibits high affinity to scDNA suggesting that the C-terminal DNA-binding domain plays major role in strong supercoil-selective interaction of the p53 protein.

p53 protein binding to scDNA was also followed by means of electron microscopy. Multiple complexes positioned at free DNA segments and apparently at DNA crossovers and protein-DNA filaments were observed. In the latter case two DNA strands are stabilized via bound protein molecules. The role of different p53 domains for this new p53 binding mode will be discussed.

Refrences and Footnotes
  1. Janus, F., Albrechtsen, N., Dornreiter, I., Wiesmuller, L., Grosse, F. and Deppert, W. Cell Mol Life Sci 55, 12-27 (1999)
  2. V.Brazda, J.Palecek, S.Pospisilova, B.Vojtesek, E.Palecek,Biochem Biophys Res Commun 3, 934-939 (2000).
  3. E. Palecek, D. Vlk, V. Stankova, V. Brazda, B. Vojtesek, T. R. Hupp, A. Schaper and T. M. Jovin, Oncogene 15, 2201-2209 (1997).
  4. E. Palecek, M. Brazdova, H. Cernocka, D. Vlk, V. Brazda and B. Vojtesek, Oncogene 18, 3617-3625 (1999).
  5. M. Fojta, T. Kubicarov?, B. Vojtesek and E. Palecek, J. Biol. Chem. 274, 25749-25755 (1999).
  6. Palecek, E., Brazdova, M., Brazda, V., Palecek, J., Billova, S., Subramaniam, V. and Jovin, T. M. Eur J Biochem 268, 573-581 (2001).

J. Palecek(1), M. Brazdova(1), M.Fojta(1), D. Cherny(3), E. Jagelska(1), P. Pecinka(1), S. Billova(1), L. Karlovska(1), V. Brazda(1), S. Pospisilova(2), B. Vojtesek(2), V. Subramaniam(3), T. Jovin(3) and E. Palecek(1)

Institute of Biophysics(1), Academy of Sciences of the Czech Republic, Kralovopolska 135, 612 65 Brno, Czech Republic; Masaryk Memorial Cancer Institute(2), 656 53 Brno, Czech Republic; Max Planck Institute for Biophysical Chemistry(3), G?ttingen, Germany